문자열 내 불완전하고 완벽한 패턴 찾기

패턴을위한 뉴클레오티드 문자열 내에서 검색하기 위해 Perl 스크립트를 작업 중입니다. 지금까지 다음 정규 표현식을 사용할 수있었습니다문자열 내 불완전하고 완벽한 패턴 찾기

my $regex1 = qr/(([ACGT]{2}) \2{9,})/x; 
    my $regex2 = qr/(([ACGT]{3}) \2{6,})/x; 
    my $regex3 = qr/(([ACGT]{4}) \2{6,})/x; 
for my $regex ($regex1, $regex2, $regex3) { 
    next unless $seq1 =~ $regex; 
    printf "Matched %s exactly %d times\n", $2, length($1)/length($2); 
    printf "Length of sequence: $number \n"; 
}

어떻게하면 다음 작업을 수행 할 수 있습니까?

완벽한 (반복없이 반복됨) 및 불완전한 (반복되지만, 반복의 문자열을 뉴클레오타이드에 의해 분해 할 수 있음) 최소 10 회의 반복이 필요함.

전체 발견 순서를 -print

시료 입력 - 전체에서 GTCGTGTGTGTGTAGTGTGTGTGTGTGAACTGA

현재 스크립트

print "Di-, Tri-, Tetra-nucleotide Tandem Repeat Finder v1.0 \n\n"; 
print "Please specify the file location (DO NOT DRAG/DROP files!) then press ENTER:\n"; 
$seq = <STDIN>; 

#Remove the newline from the filename 
chomp $seq; 

#open the file or exit 
open (SEQFILE, $seq) or die "Can't open '$seq': $!"; 

#read the dna sequence from the file and store it into the array variable @seq1 
@seq1 = <SEQFILE>; 

#Close the file 
close SEQFILE; 

#Put the sequence into a single string as it is easier to search for the motif 
$seq1 = join('', @seq1); 

#Remove whitespace 
$seq1 =~s/\s//g; 

#Count of number of nucleotides 
#Initialize the variable 
$number = 0; 
$number = length $seq1; 
#Use regex to say "Find 3 nucelotides and match at least 6 times 
# qr(quotes and compiles)/(([nucs]{number of nucs in pattern}) \2{number of repeats,}/x(permit within pattern) 

my $regex1 = qr/(([ACGT]{2}) \2{9,})/x; 
my $regex2 = qr/(([ACGT]{3}) \2{6,})/x; 
my $regex3 = qr/(([ACGT]{4}) \2{6,})/x; 

#Tell program to use $regex on variable that holds the file 
for my $regex ($regex1, $regex2, $regex3) { 
    next unless $seq1 =~ $regex; 
    printf "Matched %s exactly %d times\n", $2, length($1)/length($2); 
    printf "Length of sequence: $number \n"; 
} 

exit;

출처

2013-02-23 Citizin

아마도 일부 샘플 입력/출력 및 테스트 사례를 포함해야합니다. – TLP

그리고이 샘플 입력에서 원하는 출력은 무엇입니까? 당신은 모든 사람이 생물학 용어와 DNA 전문 용어에 익숙하지 않다는 것을 알아야합니다. – TLP

네 말이 맞아. 미안해. 나는 두 개의 뉴클레오타이드가 반복되는 요소인지, 반복이 몇 번이나 발견되었는지, 전체 시퀀스 (반복이 시작되는 곳에서부터 반복이 끝나는 곳까지)를 알기 위해 결과를 필요로 할 것입니다. – Citizin

확실하지 나는 완전히 당신이 필요하지만, 아마도 이것은 당신에게 무슨 이해할 아이디어 :

use strict; # You should be using this, 
use warnings; # and this. 

my $input = 'GTCGTGTGTGTGTAGTGTGTGTGTGTGAACTGA'; 

my $patt  = '[ACGT]{2}'; # Some pattern of interest. 
my $intervene = '[ACGT]*';  # Some intervening pattern. 
my $m   = 7 - 2;   # Minimum N of times to find pattern, less 2. 

my $rgx = qr/( 
    ($patt) $intervene 
    (\2  $intervene){$m,} 
    \2 
)/x; 

print $1, "\n" if $input =~ $rgx;

또한, 전체 파일을 문자열로 읽는 더 좋은 방법은 What is the best way to slurp a file into a string in Perl?입니다.

출처

2013-02-23 15:34:37 FMc

문자열 내 불완전하고 완벽한 패턴 찾기

답변

관련 문제