DNA 시퀀스 문자열에있는 뉴클레오티드를 계산하십시오.

Question

저는이 기능을 작성 했으므로 제대로 작동하지 않습니다. 어떤 아이디어라도 제발? 나는

이

def count_nucleotides(dna, nucleotide): 
    ''' (str, str) -> int 

    Return the number of occurrences of nucleotide in the DNA sequence dna. 

    >>> count_nucleotides('ATCGGC', 'G') 
    2 
    >>> count_nucleotides('ATCTA', 'G') 
    0 
    ''' 

    num_nucleodites=0 

    for char in dna: 
     if char is ('A'or'T'or'C'or'G'): 
      num_nucleodites=num_nucleodites + 1  
    return num_nucleodites 

Answer 1

당신이 다음 ... 그것은 그들 각각 char을 확인해야한다고 생각하는 방법을 작동하지 않고 쓴 or 조건이 or를 사용하여 ... 문제가 문자 정의에 어떻게 든 이해 -

if char is 'A' or char is 'T' ... so on: 

연산자를 사용하면 더 좋은 방법을 사용할 수 있습니다.

이 시도 : -

for char in dna: 
     if char in 'ATCG': 
      num_nucleodites=num_nucleodites + 1 

---

하지만 당신은, 당신이 그들 모두 4 각 문자를 확인하지 않아도 특정 요소의 계산하려는 question 말했다 있기 때문이다. .

def count_nucleotides(dna, nucleotide): 
    num_nucleotide = 0 
    for char in dna: 
     if char == nucleotide: 
      num_nucleotide = num_nucletode + 1 
    return num_nucleotide 

또는 단지 : - - : 여기에 코드가 루프 기본 사용과 같아야 방법

def count_nucleotides(dna, nucleotide): 
    return dna.count(nucleotide) 

Answer 2

무엇 단지

이

def count_nucleotides(dna, nucleotide): 
    return dna.count(nucleotide) 

Answer 3

if char is ('A'or'T'or'C'or'G'): 

이 'A' or 'T'을 평가하고하는 것은 'A'를 반환하는 그 (마음이, 그 아마 ... 지금까지 숙제에 관한 한 비행 않을거야)에 대한 다음 char 경우 확인하는 것은 동일 - 파이썬 REPL에서 그것을 시도 :

이

>>> ('A'or'T'or'C'or'G') 
'A' 

내가 어 생각 당신이해야 할 의미가 있었다 : 그것은 당신이 당신의 코멘트 한 항에있어서, 하나 개 이상의 염기의 서열을 중복 찾고있는 것 같다

if char in ('A', 'T', 'C', 'G'): 

Answer 4

. 이는 정규 표현식으로 수행 할 수 있습니다

이

import re 
def find_overlapping(needle, haystack): 
    return len(re.findall("(?=" + needle + ")", haystack)) 

당신은 다음과 같이 사용할 수 있습니다 :

>>> find_overlapping("AGA", "AGAGAGAAGAGAG") 
5 

Answer 5

string = "ATAGTTCATGTACCGTTGCAGGGGG" 
print [(i,string.count(i)) for i in list("ACTG")]